What part of the RNA polymerase holoenzyme recognizes the consensus sequence?

/in /by

Biology homework help

Biology 351- Homework Assignment #5 (10 points)

This assignment is due on Tuesday February 20th in lab by 11:21AM. Give yourself enough time to print out your assignment in case you have printer problems. I will not accept electronic copies. Hardcopies only, and late assignments are not accepted in the biology department.

1. During transcriptional initiation RNA polymerase holoenzyme recognizes the consensus sequences within the promoter of E. coli. What part of the RNA polymerase holoenzyme recognizes the consensus sequence?

2. Does RNA polymerase holoenzyme recognize the sense, or antisense strand? The antisense strand is used for what purpose during transcription?

3. A single strand of bacterial DNA contains the base sequence

-35 -10 +1

5’ CGTGTATTGACACTGGTGAGCCACTATCGTATATTCCCTAAGTGAGTATTGG 3’

a. What is the complementary sequence? Draw or type this sequence just below and indicate its polarity (directionality) in order to create a double-stranded DNA sequence.

b. Under the double-stranded DNA sequence, draw or type the mRNA sequence that will be translated, and indicate its polarity.

c. Which strand of the DNA serves as the coding strand, and which serves as the template strand, for the synthesis of the RNA transcript for this hypothetical gene fragment.

4. If a stop codon is not included in the mRNA molecule, how would this affect the following:

a. translocation on the mRNA by polyribosomes

b. concentration of this specific polypeptide in the cell

5. How many different types of tRNA molecules exist in the cell? For what purpose (hint: why are there 20 different tRNA molecules)?

DO YOU HAVE AN URGENT TASK? GET HELP NOW!.

Order Now

You might also like
Brian, a 35-year-old attorney and father of two, complains of having been advised by his supervisor to seek medical attention as he often misplaces his keys, misses his appointments, has a tendency to interrupt people during meetings, and appears to party excessively on weeknights.
What do you see going on that is a violation of the Hobbes/Locke social contract idea?
On time pleasw
Discuss any topic of your choice using Cause and Effect. You can have multiple causes and a single effect, or one cause and multiple effects.
thoroughly-review-all-of-the-provided-documentation-and-resources-before-beginning-this-task-download-the-couch-db-installer-application-and-install-the-software-explore-the-fauxton-application-to-become-familiar-with-its-functionality-import-the-sample-r
In a flow chart, illustrate how the health care policy became law.
Create a 2-3 page paper that explains your viewpoint on the Benefits of Regulatory Agencies providing Health Care Services or the Issues with Regulatory agencies in providing Health Care Services.
week-13-technology-roadmap